View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14075_low_14 (Length: 202)
Name: NF14075_low_14
Description: NF14075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14075_low_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 15 - 184
Target Start/End: Complemental strand, 17301282 - 17301110
Alignment:
| Q |
15 |
gagatgaaacgttcagcttttctatttgtttcaactttggtctgggggagagggagaggggatttcagtgccgaggagttcttctgactcctcataggac |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17301282 |
gagatgaaacgttcagcttttctatttgtttcagctttggtctgggggagagggagaggggatttcagtgccgaggagttcttctgactcctcataggac |
17301183 |
T |
 |
| Q |
115 |
agttgtggttgc---ggaagacgagacggggagggtcatccagtactgaggagtagtttcgagacaggaatgt |
184 |
Q |
| |
|
||||| ||| || || |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
17301182 |
agttgcggtcgcggtggtagacgagacggggagggtcatccagtactgaggagtagtttcgagagaggaatgt |
17301110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University