View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14077_low_3 (Length: 379)
Name: NF14077_low_3
Description: NF14077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14077_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 283; Significance: 1e-158; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 67 - 369
Target Start/End: Original strand, 44692796 - 44693098
Alignment:
| Q |
67 |
gcggtggaatcttcgtaggaggaatgccctccccccggaggtttcggttagatgtgtgttgtgcgaggaggagatggaaagatctaatcacctttttgtg |
166 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
44692796 |
gcggtggaatcttcgtagaaggaatgccctccccccggaggtttcggttagatgtgtgttgtgcgaggaggaaatggaaatatctaatcacctttttgtg |
44692895 |
T |
|
| Q |
167 |
cattgtccggtggctagagggatttggttggagcttctcaagtgggttgatagtatgtttataatgccgcaaagtgtttttaatcattggttctgttgga |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
44692896 |
cattgtccggtggctagagggatttggttggagcttctcaagtgggttgatagtatgtttataatgccgcaaagtgtttttaatcattggctctgttgga |
44692995 |
T |
|
| Q |
267 |
atgcgggagcctctaataagaagatgattaagggatttagactcatttggcacgcgacaatttgggtgatttggaaagcgagaaatgataagatatttga |
366 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
44692996 |
atgcgggagcctctaataagaagatgattaagggatttagactcatttggcacgcgacaatttgggtgatttggaaagcgagaaatgataagatatttaa |
44693095 |
T |
|
| Q |
367 |
tga |
369 |
Q |
| |
|
||| |
|
|
| T |
44693096 |
tga |
44693098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 44692686 - 44692758
Alignment:
| Q |
1 |
aataggtggagtgtggaggagttgggagttttttctcaactttggaaaagcccggctccgtcaaaagcggtgg |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44692686 |
aataggtggagtgtggaggagttgggagttttttctcaactttggaaaagcccggctccgtcaaaagtggtgg |
44692758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 92 - 360
Target Start/End: Complemental strand, 34866371 - 34866103
Alignment:
| Q |
92 |
gccctccccccggaggtttcggttagatgtgtgttgtgcgaggaggagatggaaagatctaatcacctttttgtgcattgtccggtggctagagggattt |
191 |
Q |
| |
|
||||| || |||||||| ||||| || |||| || ||||||| |||| ||||| ||| | |||||| || | ||||||| ||||||||||||||||| |
|
|
| T |
34866371 |
gcccttcctccggaggtctcggtgaggtgtgctttatgcgaggttgagacggaaacatccattcacctcttcgcgcattgtatggtggctagagggattt |
34866272 |
T |
|
| Q |
192 |
ggttggagcttctcaagtgggttgatagtatgtttataatgccgcaaagtgtttttaatcattggttctgttggaatgcgggagcctctaataagaagat |
291 |
Q |
| |
|
|||| || || || ||||||||||||| ||||||| | ||||| |||| |||||||||||||||||| |||||||||||||| |||||||||||||| | |
|
|
| T |
34866271 |
ggttagaactccttaagtgggttgataatatgtttttgatgcctcaaaatgtttttaatcattggttgtgttggaatgcgggtgcctctaataagaaatt |
34866172 |
T |
|
| Q |
292 |
gattaagggatttagactcatttggcacgcgacaatttgggtgatttggaaagcgagaaatgataagat |
360 |
Q |
| |
|
||||||||| ||||||||||||||||| || |||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
34866171 |
gattaagggttttagactcatttggcatgccgcaatttgggttatttggaagatgaggaatgataagat |
34866103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 7 - 73
Target Start/End: Complemental strand, 34866500 - 34866434
Alignment:
| Q |
7 |
tggagtgtggaggagttgggagttttttctcaactttggaaaagcccggctccgtcaaaagcggtgg |
73 |
Q |
| |
|
|||||||||||||||||| |||| ||| |||||||||||||||||||| || ||||||| ||||| |
|
|
| T |
34866500 |
tggagtgtggaggagttgagagtgtttctccaactttggaaaagcccggccccctcaaaagtggtgg |
34866434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University