View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14077_low_7 (Length: 234)
Name: NF14077_low_7
Description: NF14077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14077_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 19 - 121
Target Start/End: Original strand, 55078788 - 55078890
Alignment:
| Q |
19 |
tcatcagcgctatattggcggtaattattcttcctactccaaagtctgttgatactgccaagccttcgattgccacctctggtggccatcattgatgatc |
118 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
55078788 |
tcatcagcgctgtattggcggtaattattcttcctactccaaagtctgttgatactgccaagccatcgattgccacctctggtggccatcattgatgatc |
55078887 |
T |
 |
| Q |
119 |
aga |
121 |
Q |
| |
|
||| |
|
|
| T |
55078888 |
aga |
55078890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University