View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14077_low_9 (Length: 215)
Name: NF14077_low_9
Description: NF14077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14077_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 11 - 170
Target Start/End: Original strand, 5051299 - 5051458
Alignment:
| Q |
11 |
gaacctgtgatggttgaaagatacttttttgtgtttccatcaatgctataaaataataaggttcgcaaacgaagccttcgagtacacagtcacgtttatt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
5051299 |
gaacctgtgatggttgaaagatacttttttgtgtttccatcaatgctataaaataataaggttcgcaaacgaagccttcgagtacacggtcacgtttatt |
5051398 |
T |
|
| Q |
111 |
tctgaccggtttccagctatggagggagtggaagtttgatccaatctttcgtgaggatgt |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
5051399 |
tctgaccggtttccagctatggagggagtggaagtttgatccaatctttcgcgaggatgt |
5051458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 11 - 193
Target Start/End: Complemental strand, 51274120 - 51273943
Alignment:
| Q |
11 |
gaacctgtgatggttgaaagatacttt-tttgtgtttccatcaatgctataaaataataaggttcgcaaacgaagccttcgagtacacagtcacgtttat |
109 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| || | | ||||||||| |||||||| ||||| |||||||| ||||||| ||||||||||| |
|
|
| T |
51274120 |
gaacctgtgatggttgaaagatactttctttgtgctttctccgatgctataa-----taaggttcacaaacaaagccttctagtacacggtcacgtttat |
51274026 |
T |
|
| Q |
110 |
ttctgaccggtttccagctatggagggagtggaagtttgatccaatctttcgtgaggatgttgcatacatggtagactctacca |
193 |
Q |
| |
|
| ||||||||| || || |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
51274025 |
tg-tgaccggttcccggcggtggagggagtggaagtttgatccaatcttttgtgaggatgttgcatacatggtagactctacca |
51273943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 130 - 191
Target Start/End: Complemental strand, 14908035 - 14907974
Alignment:
| Q |
130 |
tggagggagtggaagtttgatccaatctttcgtgaggatgttgcatacatggtagactctac |
191 |
Q |
| |
|
|||||||||||||| |||||||| |||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
14908035 |
tggagggagtggaaatttgatcctatcttttgtgaggatgttgcagacatggtagactctac |
14907974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University