View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14079_high_13 (Length: 238)
Name: NF14079_high_13
Description: NF14079
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14079_high_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 20 - 221
Target Start/End: Original strand, 41732206 - 41732407
Alignment:
| Q |
20 |
acataacatacagtttacatagtagtttgtatttttctggtttcgacatttattccaatggaccagtgcctaaagacaatgtctcattagaaagagacaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41732206 |
acataacatacagtttacatagtagtttgtatttttctggtttcgacatttattccaatggaccagtgcctaaagacaatgtctcattagaaagagacaa |
41732305 |
T |
 |
| Q |
120 |
ttagaaagagacaattgtgggcataccggtgaactgtttcctcatgccattcattttctttcagattacttgctatctaaaaacatgttttggtgtgttt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41732306 |
ttagaaagagacaattgtgggcataccggtgaactgtttcctcatgccattcattttctttcagattacttgctatctaaaaacatgttttggtgtgttt |
41732405 |
T |
 |
| Q |
220 |
ct |
221 |
Q |
| |
|
|| |
|
|
| T |
41732406 |
ct |
41732407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University