View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14079_high_18 (Length: 204)
Name: NF14079_high_18
Description: NF14079
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14079_high_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 18 - 195
Target Start/End: Original strand, 44574481 - 44574658
Alignment:
| Q |
18 |
gttttgtccgttatattaggccaatgtgtctttgagctcaataagcatagaattttggtcctttgatcagttcagaacaattatcctagctcgtcatttt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
44574481 |
gttttgtccgttatattaggccaatgtgtctttgagctcaataagcatagaattttggtcctttgatcagttcagaacaattaccctagctcgtcgtttt |
44574580 |
T |
 |
| Q |
118 |
atagtttaaagtcgtgtttgtatgatgtaaatacaaagaagatctttatttgagccatatcgcacagtataatctacc |
195 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
44574581 |
atagtttagagtcgtgtttgtataatgtaaatacaaaaaagatctttatttgagccatatcgcacagtaaaatatacc |
44574658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University