View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14079_low_12 (Length: 289)
Name: NF14079_low_12
Description: NF14079
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14079_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 143; Significance: 4e-75; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 22 - 259
Target Start/End: Original strand, 18600608 - 18600853
Alignment:
| Q |
22 |
gatcacaataatccataaagagagggtgagagtccattgtatcaaaattatattattttat-----cttttgaaaatccaaaaata--attgaaagtcta |
114 |
Q |
| |
|
||||||||||||| | ||| ||||||||||| ||||||| ||||||||||||||||||||| |||||||||||||| ||||| ||||||||||| |
|
|
| T |
18600608 |
gatcacaataatcaagaaatagagggtgagactccattgcatcaaaattatattattttattttatcttttgaaaatccataaatataattgaaagtctc |
18600707 |
T |
 |
| Q |
115 |
ccatgagtaatgaaactaatgtgcgtggtaaatgttatatggtgcatgtcgtgtgagaaatataatgtgtcgtaccatataacactactcattaaaaatg |
214 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18600708 |
tgatgagtaatgaaattaatgtgtgtggtaaatgttatatggtgcatgtcgtgtgacaaatataatgtgtcgtaccatataacactactcattaaaaatg |
18600807 |
T |
 |
| Q |
215 |
tggggggca-gcaggagttttaagaggtgtctcaaactagtagaag |
259 |
Q |
| |
|
||||||||| | ||| ||||||||||||||| |||||| ||||||| |
|
|
| T |
18600808 |
tggggggcaggtaggggttttaagaggtgtcccaaactggtagaag |
18600853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University