View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14079_low_18 (Length: 217)
Name: NF14079_low_18
Description: NF14079
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14079_low_18 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 19 - 179
Target Start/End: Complemental strand, 34834890 - 34834730
Alignment:
| Q |
19 |
agagaattcgtgcatttgttcctattaattagaaataattgatgatgaataatggacaatttttgcctagaccacaaatgtacttgttcaagcttataat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34834890 |
agagaattcgtgcatttgttcctattaattagaaataattgatgatgaataatggacaatttttgcctagaccacaaatgtacttgttcaagcttataat |
34834791 |
T |
 |
| Q |
119 |
tacacataatctttgtaatacgtagttgttacttaggagataaataaaaatgttggcaatt |
179 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34834790 |
tacacataatctatgtaatacgtagttgttactcaggagataaataaaaatgttggcaatt |
34834730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University