View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1407_low_7 (Length: 393)
Name: NF1407_low_7
Description: NF1407
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1407_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 81 - 295
Target Start/End: Original strand, 36842449 - 36842663
Alignment:
| Q |
81 |
ccaagaatatcattatcttttactagaaattcaattttgtgagcaggatgagcaacaggaacaagaaaatgttcatcccataaagggttttcgcaattcg |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36842449 |
ccaagaatatcattatcttttactagaaattcaattttgtgagcaggatgagcaacaggaacaagaaaatgttcatcccataaagggttttcgcaattcg |
36842548 |
T |
|
| Q |
181 |
gaatgactcttgtttgtgctatggttgcaccagctagacaaatagatacataagggtcacttgttatgatcttgtcttttcctgagtgtgttttgagtcc |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
36842549 |
gaatgactcttgtttgtgctatggttgcaccagctagacaaatagatacataagggtcacttgttatgatcttgtcttttcctgagtgggttttgagtcc |
36842648 |
T |
|
| Q |
281 |
ttttacaaaaggtgg |
295 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
36842649 |
ttttacaaaaggtgg |
36842663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University