View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14081_high_13 (Length: 306)
Name: NF14081_high_13
Description: NF14081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14081_high_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 31 - 287
Target Start/End: Complemental strand, 40515714 - 40515475
Alignment:
| Q |
31 |
agtagcaaaggacaatcatagccacggctcaaccttaagaaattccaatccaccaccaatattttcatcaccagcggtccattgaaaacagccagtaaga |
130 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40515714 |
agtagccaaggacaatcatagccacggctcaaccttaagaaattccaatccaccaccaatattttcatcaccagc-----------------cagtaaga |
40515632 |
T |
 |
| Q |
131 |
taaggacgctgannnnnnnnnnnnnnngtgattgctagatgcaataactatttcatgccccatccaacaaccctcaacaaaattggcaattgtacataaa |
230 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40515631 |
taaggacgctgattttttttcctttttgtgattgctagatgcaataactatttcatgccccatccaacaaccctcaacaaaattggcaattatacataaa |
40515532 |
T |
 |
| Q |
231 |
aatagttattgatagacatgtcctagagttaacagtcactgccagacatgtctcaca |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40515531 |
aatagttattgatagacatgtcctagagttaacagtcactgccagacatgtctcaca |
40515475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University