View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14081_high_8 (Length: 410)
Name: NF14081_high_8
Description: NF14081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14081_high_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 76; Significance: 5e-35; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 19 - 106
Target Start/End: Original strand, 1156813 - 1156900
Alignment:
| Q |
19 |
aagggaatggataattgggaaattaagtgtggatgcccatcgatgaatttcttgtattatttttaattaaacattgatgaatttcttg |
106 |
Q |
| |
|
|||||||| ||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1156813 |
aagggaatagatgattgggaaatgaagtgtggatgcccatcgatgaatttcttgtattatttttaattaaacattgatgaatttcttg |
1156900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 182 - 217
Target Start/End: Original strand, 1156994 - 1157029
Alignment:
| Q |
182 |
cttctctctttctcttataccaaaccatacatcaaa |
217 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1156994 |
cttctctctttctcttataccaaactatacatcaaa |
1157029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University