View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14081_low_11 (Length: 332)
Name: NF14081_low_11
Description: NF14081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14081_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 242; Significance: 1e-134; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 16 - 316
Target Start/End: Original strand, 45103536 - 45103837
Alignment:
| Q |
16 |
acagaacagaacacattttcttctgatggagcaaacatgggaaaattggcctcttcattcggtaataacactagctacacatataattatttctcataag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45103536 |
acagaacagaacacattttcttctgatggagcaaacatgggaaaattggcctcttcattcggtaataacactagctacacatataattatttctcataag |
45103635 |
T |
|
| Q |
116 |
ttatactttatgnnnnnnnataaatcgtaaatcattatgatcaacnnnnnnnnn-tgttatgtatcatttatattttctcataaaccttgttttaacttt |
214 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45103636 |
ttatactttatgtttttttataaatcctaaatcattatgatcaacaaaaaaaaaatgttatgtatcatttatattttctcataaaccttgttttaacttt |
45103735 |
T |
|
| Q |
215 |
ttaactaactgtcattattacaataggaaatggttgatgtagagaatatgcaagggcaatattgtcatcaaacaagtactgatgatgaagaagagttctt |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45103736 |
ttaactaactgtcattattacaataggaaatggttgatgtagagaatatgcaagggcaatattgtcatcaaacaagtactgatgatgaagaagagttctt |
45103835 |
T |
|
| Q |
315 |
ga |
316 |
Q |
| |
|
|| |
|
|
| T |
45103836 |
ga |
45103837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 234 - 316
Target Start/End: Original strand, 45130384 - 45130466
Alignment:
| Q |
234 |
acaataggaaatggttgatgtagagaatatgcaagggcaatattgtcatcaaacaagtactgatgatgaagaagagttcttga |
316 |
Q |
| |
|
|||||||||| ||| |||||||||| | ||| ||||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
45130384 |
acaataggaattgggtgatgtagaggttttgctagggcaatattgtcatcaaactagtgctgatgatgaagaagagttcttga |
45130466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University