View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14081_low_12 (Length: 323)

Name: NF14081_low_12
Description: NF14081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14081_low_12
NF14081_low_12
[»] chr3 (1 HSPs)
chr3 (165-202)||(19852504-19852541)


Alignment Details
Target: chr3 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 202
Target Start/End: Original strand, 19852504 - 19852541
Alignment:
165 tgtatgagaaaattactacattcagcaaaattcaacat 202  Q
    ||||||||||||||||||||||||||||||||||||||    
19852504 tgtatgagaaaattactacattcagcaaaattcaacat 19852541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University