View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14081_low_13 (Length: 316)
Name: NF14081_low_13
Description: NF14081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14081_low_13 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 153; Significance: 4e-81; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 1 - 161
Target Start/End: Complemental strand, 34859975 - 34859815
Alignment:
| Q |
1 |
taggaagctagatgtttttgaagacccttattgctcgtcttctgtgtttcttctttaatttacaaagtcctggaaaagtagaagatggaagccacttcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34859975 |
taggaagctagatgtttttgaagatccttattgctcgtcttctgtgtttcttctttaatttacaaagtcctggaaaagtagaagatggaagccacttcaa |
34859876 |
T |
 |
| Q |
101 |
taacacaaatgttgaagggtttttgtgatactatctatctatgcaatggttatcagtatgt |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34859875 |
taacacaaatgttgaagggtttttgtgatactatctatctatgcaatggttatcaatatgt |
34859815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 138 - 210
Target Start/End: Complemental strand, 34859795 - 34859723
Alignment:
| Q |
138 |
tctatgcaatggttatcagtatgttaagacgagttgaagattaaagccaatccaatgacacaattgttgaagg |
210 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34859795 |
tctatgaaatggttatcagtatgttaagacgagttgaagattaaagccaatccaatgacacaattgttgaagg |
34859723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 208 - 264
Target Start/End: Complemental strand, 34859640 - 34859584
Alignment:
| Q |
208 |
aggatagttatatgattgtctttctatgaatttcgttacaaatattctatgacaaca |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34859640 |
aggatagttatatgattgtctttctatgaatttcgttacaaatattctatgacaaca |
34859584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 43 - 134
Target Start/End: Complemental strand, 23133073 - 23132979
Alignment:
| Q |
43 |
tgtgtttcttctttaatttac---aaagtcctggaaaagtagaagatggaagccacttcaataacacaaatgttgaagggtttttgtgatactat |
134 |
Q |
| |
|
|||||||||| |||| ||||| |||||| || ||||||||||||||||||| |||||||| |||||| |||||||||| |||||||||||||| |
|
|
| T |
23133073 |
tgtgtttcttgtttattttaccgaaaagtcgtgcaaaagtagaagatggaagctacttcaattacacaattgttgaagggcttttgtgatactat |
23132979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University