View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14081_low_8 (Length: 410)

Name: NF14081_low_8
Description: NF14081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14081_low_8
NF14081_low_8
[»] chr5 (2 HSPs)
chr5 (19-106)||(1156813-1156900)
chr5 (182-217)||(1156994-1157029)


Alignment Details
Target: chr5 (Bit Score: 76; Significance: 5e-35; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 19 - 106
Target Start/End: Original strand, 1156813 - 1156900
Alignment:
19 aagggaatggataattgggaaattaagtgtggatgcccatcgatgaatttcttgtattatttttaattaaacattgatgaatttcttg 106  Q
    |||||||| ||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1156813 aagggaatagatgattgggaaatgaagtgtggatgcccatcgatgaatttcttgtattatttttaattaaacattgatgaatttcttg 1156900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 182 - 217
Target Start/End: Original strand, 1156994 - 1157029
Alignment:
182 cttctctctttctcttataccaaaccatacatcaaa 217  Q
    ||||||||||||||||||||||||| ||||||||||    
1156994 cttctctctttctcttataccaaactatacatcaaa 1157029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University