View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14082_high_14 (Length: 272)
Name: NF14082_high_14
Description: NF14082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14082_high_14 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 272
Target Start/End: Original strand, 5031399 - 5031673
Alignment:
| Q |
1 |
taaaaccacttaggagtttaattcaaaataaagcaaaaacataattttaatccaagttaattgaacatttttaaatgcttcattaagtgcgataactcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5031399 |
taaaaccacttaggagtttaattcaaaataaagcaaaaacataattttaatccaagttaattgaacatttttaaatgcttcattaagtgcgataactcaa |
5031498 |
T |
 |
| Q |
101 |
aggaaagcataactagaat---taatgaatcggggatttttatctnnnnnnnnnnnntcatactttaagaaatcactaatccaattagtaagttgatgta |
197 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |||| |||||||||||||||||||| ||||||||||||| ||| |||| |
|
|
| T |
5031499 |
aggaaagcataactagaattaataatgaatcggggatttgaatctaaaaaacaaaaatcatactttaagaaatcactgatccaattagtaacttgttgta |
5031598 |
T |
 |
| Q |
198 |
gttacaattaatctctaaaataaacatcgacactatctcaaactagtagcatttgaattaaaaaattgttgtgca |
272 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5031599 |
gttacaattaatctctaaaataaacatcaacactatctcaaactagtagcatttgaattaaaaaattgttgtgca |
5031673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University