View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14082_high_15 (Length: 245)
Name: NF14082_high_15
Description: NF14082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14082_high_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 20 - 231
Target Start/End: Original strand, 36104992 - 36105203
Alignment:
| Q |
20 |
aacatcacgctccttcctccgacccacgctggtcagccattcaccggatccaatccgaatccccttctcgtcgcatcctcccctccgacctccgcttctc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36104992 |
aacatcacgctccttcctccgacccacgctggtcagccattcaccggatccaatccgaatccccttctcgtcgcatcctcccctccgacctccgcttctc |
36105091 |
T |
 |
| Q |
120 |
ccgccgtctcggctccggcgacatcagctctgtctacctcgctgaacttaatgacgacggcaagattccggcgatgtttgcggcgaaagtgatggataag |
219 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36105092 |
ccaccgtctcggctccggcgacatcagctctgtctacctcgctgaacttaatgacgacggcaagattccggcgatgtttgcggcgaaagtgatggataag |
36105191 |
T |
 |
| Q |
220 |
aaggagcttgtt |
231 |
Q |
| |
|
|||||||||||| |
|
|
| T |
36105192 |
aaggagcttgtt |
36105203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University