View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14083_high_5 (Length: 332)
Name: NF14083_high_5
Description: NF14083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14083_high_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 18 - 321
Target Start/End: Original strand, 38338041 - 38338346
Alignment:
| Q |
18 |
tttgggacgataatctattttcgcagtcacaaaatccgttttccaatctaaatcaacaatcagaattcaatgattttgattctcatacggagtcaggttc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38338041 |
tttgggacgataatctattttcgcagtcacaaaatccgttttccaatctaaatcaacaatcagaattcaatgattttgattctcatacggagtcaggttc |
38338140 |
T |
|
| Q |
118 |
ttccattaggcctttcttctggaataatgatcaaaattaaacttgaagttttcttttgtcctcaaaccaatggttgctgatatttttaccagacaacctt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38338141 |
ttccattaggcctttcttctggaataatgatcaaaattaaacttgaagttttcttttgtcctcaaaccaatggttgctgatatttttaccagacaacctt |
38338240 |
T |
|
| Q |
218 |
tgagcttaagggtcatataccttatagtcttacctttgttcatttaac--nnnnnnnnnnctcaactcttttgtactatttagttgctttttattgattt |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| | |
|
|
| T |
38338241 |
tgagcttaagggtcatataccttatagtcttacctttgttcatttaactttattttttttcttaactcttttgtactatttagttgctttttattgatgt |
38338340 |
T |
|
| Q |
316 |
agtata |
321 |
Q |
| |
|
|||||| |
|
|
| T |
38338341 |
agtata |
38338346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University