View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14084_high_15 (Length: 313)
Name: NF14084_high_15
Description: NF14084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14084_high_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 1 - 294
Target Start/End: Complemental strand, 42590472 - 42590180
Alignment:
| Q |
1 |
gtttagaggggtgtccatatgacgacggtcattctcgacccgcaagagaggatatccagatccgtcacagattgggacttagttcagactaaaacaatta |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
42590472 |
gtttagaggggtgtctatatgacgacggtcattctcgacccgtaagagaggatatccagatccgtcacagattgggacttagttcagactaaaacagtta |
42590373 |
T |
 |
| Q |
101 |
tcctccaagcctattaatcgagagaatcaagtgatggcttgcccttgtagttttaagagtacgaggcccaacctattaaaggggttcaacatagttctaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42590372 |
tcctccaagcctattaatcgagagaaccaagtgatggcttgcccttgtagttttaagagtacgaggcccaacctattaaaggggttcaacatagttctaa |
42590273 |
T |
 |
| Q |
201 |
ttctcaagccttcacaccatcttgtgagatttgggtcgctagtacgttacgtgagctatgagttcgtaacgtggggtccgactttaggcagatg |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42590272 |
ttctcaagccttcacaccatcttgtgagatttgggtcgctagtacgttacgtgagctatgagttcgtaacgt-gggtccgactttaggcagatg |
42590180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University