View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14084_high_21 (Length: 226)
Name: NF14084_high_21
Description: NF14084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14084_high_21 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 117 - 226
Target Start/End: Original strand, 2199028 - 2199138
Alignment:
| Q |
117 |
gtaggaataaaacatcctaatagaaagtattatccgctgtttcaagcagcccactgaaatcctaaacatggcccctggtttttagtttcacttccc-taa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
2199028 |
gtaggaataaaacatcctaatagaaagtattatccgctgtttcaagcagcccactgaaatcctaaacatggcccctggtttttagtttcacttcccttaa |
2199127 |
T |
 |
| Q |
216 |
accacctctct |
226 |
Q |
| |
|
||||||||||| |
|
|
| T |
2199128 |
accacctctct |
2199138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University