View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14084_low_16 (Length: 322)
Name: NF14084_low_16
Description: NF14084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14084_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 131; Significance: 6e-68; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 2199580 - 2199347
Alignment:
| Q |
1 |
gccgccggttcttccttggtttcatgttattggtatttgactcatcaagtaattcacataactccctcccttttctttcaaccatgtttctctcaattcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2199580 |
gccgccggttcttccttggtttcatgttattggtatttgtctcatcaagtaattcacataactccctcccttttctttcaaccatgtttctctcaattcc |
2199481 |
T |
|
| Q |
101 |
cattgaaacagagcaataa----------------------aaaacagagc-aaaaacagacccagatatgaaaaacgaatcaaagagaggatttttgta |
177 |
Q |
| |
|
|||||||||||||||| || |||||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
2199480 |
cattgaaacagagcaaaaatacagagcaaaaacagagtataaaaacagagcaaaaaacagacccagataggaaaaacgaatcaaagagaagatttttgta |
2199381 |
T |
|
| Q |
178 |
gaggaatgg-ttttgatatgaatcaagagtgttg |
210 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
2199380 |
gaggaatggtttttgatatgaatcaagagtgttg |
2199347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University