View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14084_low_18 (Length: 311)
Name: NF14084_low_18
Description: NF14084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14084_low_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 18 - 302
Target Start/End: Original strand, 6221500 - 6221784
Alignment:
| Q |
18 |
aacaaaacaccaagcatcggattctgaccaatctaacggtctttcatttgtgactagtcgttgaagcctctcgcccggtgaacaaaaaccttgctcaaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
6221500 |
aacaaaacaccaagcatcggattctgaccaatctaacggtctttcatttgtgactagtcgttgaagactctcgcccggtgaacaaaaaccttgctcaaat |
6221599 |
T |
|
| Q |
118 |
ttcagttcacatacttcctttgcatcaggaggcaaagtcgtaacactagaagaagcccaatgaggaaaatcgaagtgagttctcggagatggtgatattg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6221600 |
ttcagttcacatacttcctttgcatcaggaggcaaagtcgtaacactagaagaagcccaatgaggaaaatcgaagtgagttctcggagatggtgatattg |
6221699 |
T |
|
| Q |
218 |
acaatggcaactcattcatcaactctttcaccaatgaaacagtttcatcacctgagataaactcatgtttcaaaagcatctctgc |
302 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6221700 |
acaatggcaactcattgatcaactctttcaccaatgaaacagtttcatcacctgagataaactcatgtttcaaaagcatctctgc |
6221784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University