View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14084_low_19 (Length: 303)
Name: NF14084_low_19
Description: NF14084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14084_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 3e-91; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 108 - 290
Target Start/End: Complemental strand, 4884739 - 4884553
Alignment:
| Q |
108 |
gtaaagaagaaaataaactttgtttctgtcaattttgtgtacatatggttaaaattttagtgctatgataaaatgttatatatggttttgattttgttaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4884739 |
gtaaagaagaaaataaactttgtttctgtcaattttgtgtacatatggttaaaattttagtgctatgataaaatgttatatatggttttgattttgttaa |
4884640 |
T |
 |
| Q |
208 |
gttgaagacttgaactagaaggaagaaatcatcttgaaagttgacac----taagcttatagatcacatacttgtaagaggttgatg |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4884639 |
gttgaagacttgaactagaaggaagaaatcatcttgaaagttgacactaattaagcttatagatcacatacttgtaagaggttgatg |
4884553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 18 - 49
Target Start/End: Complemental strand, 4884830 - 4884799
Alignment:
| Q |
18 |
ctttatcaatatctttgttgtttcatcttcaa |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
4884830 |
ctttatcaatatctttgttgtttcatcttcaa |
4884799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University