View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14085_high_5 (Length: 268)
Name: NF14085_high_5
Description: NF14085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14085_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 9 - 245
Target Start/End: Original strand, 10760108 - 10760344
Alignment:
| Q |
9 |
gtgagatgaagcaacccaaagaacattactattacatttttcttctcgttttgggtttctctcatgaaagatcatagaaaacatagcagagccatttcat |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10760108 |
gtgacatgaagcaacccaaagaacattactattacatttttcttctcgttttgggtttctctcatgaaagatcatagaaaacatagcagagccatttcat |
10760207 |
T |
 |
| Q |
109 |
ggagcacattcttctggttcactattgtggttgtcttatcttccattatctttacctccctaattatttcatccatccaccccttctacctccctcgatt |
208 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10760208 |
ggagcacattcttttggttcactattgtggttgtcttatcttccattatctttacctccctaattatttcatccatccaccccttctacctccctcgatt |
10760307 |
T |
 |
| Q |
209 |
tcacatcccaattgcagctttgaaatggccaactcca |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10760308 |
tcacatcccaattgcagctttgaaatggccaactcca |
10760344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University