View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14085_low_8 (Length: 214)
Name: NF14085_low_8
Description: NF14085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14085_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 24 - 200
Target Start/End: Complemental strand, 36563211 - 36563035
Alignment:
| Q |
24 |
atgatgacccttctgttcagattcaaaatctcaagaatctcaacaacgttctactcaaagaaaccaccaatcacagaaaccgcattcagttacttctcaa |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36563211 |
atgatgacccttctgttcagattcaaaatctcaagaatctcaacaacgttcttctcaaagaaaccaccaatcacagaaaccgcattcagttacttctcaa |
36563112 |
T |
|
| Q |
124 |
agctaaccacgccgccatggatgttgaagacaaaaatctcgccttggaccttcaaaacgatgttttctttgtttttg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36563111 |
agctaaccacgccgccatggatgttgaagacaaaaatctcgccttggaccttcaaaacgatgttttctttgtttttg |
36563035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University