View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14087_high_3 (Length: 237)
Name: NF14087_high_3
Description: NF14087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14087_high_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 38466157 - 38465937
Alignment:
| Q |
1 |
gtaacgcaagtttagccagtgaaatcttatcctacgttagttagggtatgggcctatgatttatgggctgaaaaatggtgtttcagcctaagcccagaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38466157 |
gtaacgcaagtttagccagtgaaatcttatcctacgttagttagggtatgggcctatgatttatgggctgaaaaatggtgtttcagcctaagcccagaga |
38466058 |
T |
 |
| Q |
101 |
aaaatcgcaaaaaggttgctattaatcaaaggtcatgagtttgaatcttgactcgagagactagtctctgcagttgtgtgcagagatactcagtacatac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38466057 |
aaaatcgcaaaaaggttgctattaatcaaaggtcatgagtttgaatctcgactcgagagactagtctctgcagttgtgtgcagagatactcagttcatac |
38465958 |
T |
 |
| Q |
201 |
aaacaattataatatcttttg |
221 |
Q |
| |
|
||| ||||||||||||||||| |
|
|
| T |
38465957 |
aaaaaattataatatcttttg |
38465937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University