View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14087_low_4 (Length: 229)
Name: NF14087_low_4
Description: NF14087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14087_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 17 - 215
Target Start/End: Complemental strand, 39582891 - 39582693
Alignment:
| Q |
17 |
agcatgtttaagaagcacaatcttctagttcagattttcgttttttgtacaagatatcatataaatgttccaagaaacttcatatatagttcatatttca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39582891 |
agcatgtttaagaagcacaatcttctagttcagattttcgttttttgtacaagatatcatataaatgttccaagaaacttcatatatagttcatatttca |
39582792 |
T |
 |
| Q |
117 |
tggtacccagctgcttgattcgtcgagactgttctgttactaaataaaaattctcatctctccctccctctctcaagtgtcttctgttttgttcttttc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39582791 |
tggtacccagctgcttgattcgtcgagactgttctgttactaaataaaaattctcatctctccctccctctctcaagtgtcttccgttttgttcttttc |
39582693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University