View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14088_low_4 (Length: 331)
Name: NF14088_low_4
Description: NF14088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14088_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 7 - 302
Target Start/End: Original strand, 30115078 - 30115377
Alignment:
| Q |
7 |
tgaatcccatggtcaaaattttcctgccaagttggttgctgcattaggtaataatggattaaaatacccttatttaatttctagtatttgtaat----tg |
102 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| || |
|
|
| T |
30115078 |
tgaatcccatggtcaaaagtttcctgccaagttggttgctgcattaggtaatattggactaaaatacccttatttaatttctagtatttgtaattaattg |
30115177 |
T |
 |
| Q |
103 |
taacagaaatgtctaagttctttgtcacaactaagggtatagctgaaaaatcactcactagacattggatttctaaggtatcaatagttttgaaacaaaa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30115178 |
taacagaaatgtctaagttctttgtcacaactaagggtatagctgaaaaatcactcactagacattggatttctaaggtatcaatagttttgaaacaaaa |
30115277 |
T |
 |
| Q |
203 |
ggaagtgatagattagaaaacaaattgagcggtgaattaatgctagnnnnnnnnaatccttttttggcccctagagagaaatagactaaacatgtaatag |
302 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30115278 |
ggaagtgatagattagaaaacaaattgagttgtgaattaatgctagttttttttaatccttttttggcccctagagagaaatagactaaacatgtaatag |
30115377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University