View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14088_low_6 (Length: 308)
Name: NF14088_low_6
Description: NF14088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14088_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 16 - 292
Target Start/End: Complemental strand, 25115167 - 25114892
Alignment:
| Q |
16 |
atcaaccttgattgtgatattatcaacaatttggacccaagatttcatggattcttgtgtcaaatttatgttgggagcataaaattccaattcttcaata |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25115167 |
atcaaccttgattgtgatattatcaacaatttggacc-aagatttcatggattcttgtgtcaaatttatgttgggagcataaaattccaattcttcaata |
25115069 |
T |
 |
| Q |
116 |
ttggcttttgcatagaaaggagagcatgcacatatagcacccactactaagtgctcttcttccatctatctaggtgttcacaaaaaagaaatcagagaat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25115068 |
ttggcttttgcatagaaaggagagcatgcacatatagcacccactactaagtgctcttcttccatctatctaggtgttcacaaaaaagaaatcagagaat |
25114969 |
T |
 |
| Q |
216 |
attttcgaacacagatacctccctttcactcctcaatcatctacttcacttttacttgttttgtgcaatgacccatg |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25114968 |
attttcgaacacagatacctccctttcactcctcaatcatctacttcacttttacttgttttgtgcaatgacccatg |
25114892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University