View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_high_105 (Length: 273)
Name: NF1408_high_105
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_high_105 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 68 - 197
Target Start/End: Original strand, 29215323 - 29215455
Alignment:
| Q |
68 |
actaagaatacttgtcgacgctcttg---cattgcgtttattaaggcctacatgaaagtgcattgcaaaataaacatttcgaacacatgtgtaataatac |
164 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29215323 |
actaagaatacttgtcgacgctcttgttgcattgcgtttattaaggcctacatgaaagtgcattgcaaaataaacatttcgaacacatgtgtaataatac |
29215422 |
T |
|
| Q |
165 |
gcatatacttagcacatgtgaattagtatttaa |
197 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
29215423 |
gcatatacttagcacatgtgaattagtacttaa |
29215455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University