View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_high_106 (Length: 269)
Name: NF1408_high_106
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_high_106 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 33 - 222
Target Start/End: Complemental strand, 12721003 - 12720814
Alignment:
| Q |
33 |
gaacaagagatatcaatatatacaaatacattatccaaaattgaaggtgccggcatgttcttcaacattccaaagccaggttcagtgtgagcatacgatt |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12721003 |
gaacaagagatatcaatatatacaaatacattatccaaaattgaaggtgccggcatgttcttcaacattccaaagccaggttcagtgtgagcatacgatt |
12720904 |
T |
|
| Q |
133 |
gaaagttcaaccaaatccagcatggaaactttcacatgtaagatgggtcacttagcacatggcatgttcttgctatgtgtggcccctaag |
222 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12720903 |
gaaagttgaaccaaatccagcatggaaactttcacatgtaagatgggtcacttagcacatggcatgttcttgctatgtgtggcccctaag |
12720814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 33 - 222
Target Start/End: Complemental strand, 12782218 - 12782029
Alignment:
| Q |
33 |
gaacaagagatatcaatatatacaaatacattatccaaaattgaaggtgccggcatgttcttcaacattccaaagccaggttcagtgtgagcatacgatt |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12782218 |
gaacaagagatatcaatatatacaaatacattatccaaaattgaaggtgccggcatgttcttcaacattccaaagccaggttcagtgtgagcatacgatt |
12782119 |
T |
|
| Q |
133 |
gaaagttcaaccaaatccagcatggaaactttcacatgtaagatgggtcacttagcacatggcatgttcttgctatgtgtggcccctaag |
222 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12782118 |
gaaagttgaaccaaatccagcatggaaactttcacatgtaagatgggtcacttagcacatggcatgttcttgctatgtgtggcccctaag |
12782029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 194 - 222
Target Start/End: Complemental strand, 12783806 - 12783778
Alignment:
| Q |
194 |
gcatgttcttgctatgtgtggcccctaag |
222 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
12783806 |
gcatgttcttgctatgtgtggcccctaag |
12783778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University