View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_high_108 (Length: 265)
Name: NF1408_high_108
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_high_108 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 128 - 236
Target Start/End: Original strand, 372183 - 372291
Alignment:
| Q |
128 |
aattggtggttgcacttgcaccatttaatttaatggttgcgttgcggcataaactagttttccatcacatgacgtgtcccacgtttttattaaaggaaca |
227 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
372183 |
aattggtggttgcacttgcatcatttaatttaatggttgcgttgcggcataaactagttttccatcacatgacgtgtcccacgtttttattaaaggaaca |
372282 |
T |
 |
| Q |
228 |
tgaaggccc |
236 |
Q |
| |
|
||||||||| |
|
|
| T |
372283 |
tgaaggccc |
372291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 33 - 61
Target Start/End: Original strand, 372088 - 372116
Alignment:
| Q |
33 |
taataattatcctttctaacaacaaaggc |
61 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
372088 |
taataattatcctttctaacaacaaaggc |
372116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 30
Target Start/End: Complemental strand, 2038126 - 2038097
Alignment:
| Q |
1 |
ctcaaaattgtggatgtaccatagaagttc |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
2038126 |
ctcaaaattgtggatgtaccatagaagttc |
2038097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University