View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_high_112 (Length: 262)
Name: NF1408_high_112
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_high_112 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 30 - 262
Target Start/End: Complemental strand, 39663102 - 39662867
Alignment:
| Q |
30 |
ctttctgctattcggaacaactgccaatataat---ttgggccaggcccatcataaactaaagaccgttgatgccgtcagttctgagtctgggtctgatt |
126 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39663102 |
ctttctgctattaggaacaactgccaatataataatttgggccaggcccatcataaactaaagaccgttgatgccgttagttctgagtctgggtctgatt |
39663003 |
T |
 |
| Q |
127 |
tctcgattttggcctctactgtgcacgtgtaggacactatacagttagtgtcctacctgtgaccttatttaggtcgcaaagtagagttgtcactttggtt |
226 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| |||||||| |||| ||||||||| ||||||| |||||||||||||||||||| |||| |
|
|
| T |
39663002 |
tctcaattttggcctctactgtgcacgtgtaggacactataccgttagtgttctacgtgtgaccttgtttaggttgcaaagtagagttgtcacttcggtt |
39662903 |
T |
 |
| Q |
227 |
cttcatctagaacccttatgtattatcattgaataa |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
39662902 |
cttcatctagaacccttatgtattatcattgaataa |
39662867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University