View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_high_113 (Length: 262)
Name: NF1408_high_113
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_high_113 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 30 - 253
Target Start/End: Complemental strand, 2347535 - 2347312
Alignment:
| Q |
30 |
cttagctctagacatgcttcttaaagcaagtttctatgtgtggccacggtaaaactcaaacaaaatgctaagattcatttaaccaaaataatcaaaatgc |
129 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2347535 |
cttagatctagacatgcttcttaaagcaagtttctatgtgtggccacggtaaaactcaaacaaaatgctaagattcatttaaccaaaataatcaaaatgc |
2347436 |
T |
 |
| Q |
130 |
agggtaaaaatgatagacaaacttttaagggaacaattgcatcacaacacatcattcacatgacgcgtaccgcaaacccgtaccaacatgaattgcaaat |
229 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2347435 |
agagtaaaaatgatagacaaacttttaagggaacaattgcatcacaacacatcattcacatgtcgcgtaccgcaaacccgtaccaacatgaattgcaaat |
2347336 |
T |
 |
| Q |
230 |
tatgtgactattgttcatctcact |
253 |
Q |
| |
|
||||||||||| ||||| |||||| |
|
|
| T |
2347335 |
tatgtgactatggttcaactcact |
2347312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 80 - 120
Target Start/End: Original strand, 2489947 - 2489987
Alignment:
| Q |
80 |
aaaactcaaacaaaatgctaagattcatttaaccaaaataa |
120 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
2489947 |
aaaactcaaacaaaatgctaagaatcgtttaaccaaaataa |
2489987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 72 - 120
Target Start/End: Complemental strand, 2626507 - 2626459
Alignment:
| Q |
72 |
gccacggtaaaactcaaacaaaatgctaagattcatttaaccaaaataa |
120 |
Q |
| |
|
||||| |||||||||||| ||||||||||| ||||||| ||||||||| |
|
|
| T |
2626507 |
gccacagtaaaactcaaatgaaatgctaagaatcatttatccaaaataa |
2626459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University