View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_high_117 (Length: 261)
Name: NF1408_high_117
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_high_117 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 30 - 261
Target Start/End: Original strand, 46819566 - 46819806
Alignment:
| Q |
30 |
gatgacaaataactcctccatatctctttacctacaattataaaattactagatggatttcaactattctcaaatatcaatcttacgaattaattgcttt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46819566 |
gatgacaaataactcctccatatctctttacctacaattataaaattactagatggatttcaactattctcaaatatcaatcttacgaattaattgcttt |
46819665 |
T |
|
| Q |
130 |
acataattacaaa----------tatatcagtgatgtcgtggttattttcaagttcaacaaaaaagtataacatggattattcatagtccagcatatcaa |
219 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
46819666 |
acataattacaaatttaccaaactatatcagtgatgtcgtggttattttcaagtttaacaaaaaagtataacatggattattcatagtcaagcatatcaa |
46819765 |
T |
|
| Q |
220 |
ttgatggctagtcaaaagattaactatcagaaaggaatgtgc |
261 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46819766 |
ttg-tggctagtcaaaagattaactatcagaaaggaatgtgc |
46819806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University