View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_high_118 (Length: 260)
Name: NF1408_high_118
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_high_118 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 164 - 260
Target Start/End: Original strand, 47348195 - 47348291
Alignment:
| Q |
164 |
ttcattaccttcaacacatgggggcaaaaggtcaccagtttcagttgtctcatctcttcttataattgtgttaacagcatcattgagtcggtcccat |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47348195 |
ttcattaccttcaacacatgggggcaaaaggtcaccagtttcagttgtctcatctcttcttataattgtgttaacagcatcattgagtcggtcccat |
47348291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 41 - 78
Target Start/End: Original strand, 47348072 - 47348109
Alignment:
| Q |
41 |
cacatcactaccagctcaataacacataaaatcagctc |
78 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
47348072 |
cacaacactaccagctcaataacacataaaatcagctc |
47348109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University