View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_high_125 (Length: 253)
Name: NF1408_high_125
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_high_125 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 43184655 - 43184901
Alignment:
| Q |
1 |
tttttaagaagcatgtagagacagtgtaaattaagtatgttgcctttctcaaagcgatcgcctctttccctatttctagggtttgaggttcataatattt |
100 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43184655 |
tttttaagaagcatgtggaaacagtgtaaattaagtatgttgtctttctcaaagcgatcgcctctttccctatttctagggtttgaggttcataatattt |
43184754 |
T |
 |
| Q |
101 |
gccactgttgaaaagccaatacaaggccattaatttgatcatgaggg--------atgttttagagagagtgtgtgtagaatcaaagctaaaagtatgat |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43184755 |
gccactgttgaaaagccaatacaaggccattaatctgatcatgagggatttagacatgttttagagagagtgtgtgtagaatcaaagctaaaagtatgat |
43184854 |
T |
 |
| Q |
193 |
taaatgcggagtaatactagcactacttatttgacttgaccacttcc |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43184855 |
taaatgcggagtaatactagcactacttatttgacttgaccacttcc |
43184901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University