View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_high_134 (Length: 251)
Name: NF1408_high_134
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_high_134 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 249
Target Start/End: Original strand, 29793441 - 29793689
Alignment:
| Q |
1 |
ttgccaaaggttgcgtttttgaaagcttctgaagatgaagctgagtttattgatttggaggaagtgagaaaatggtgttgcgtggtggtcacgcatggga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29793441 |
ttgccaaaggttgcgtttttgaaagcttctgaagatgaagctgagtttattgatttggaggaagtgagaaaatggtgttgcgtggtggtcacgcatggga |
29793540 |
T |
|
| Q |
101 |
aagatgggtgtgaggttttctcgaaagatgggtgtttgatggttgatccttttgaagcttgtcaggttgatccaactggggcgggggattgttttcttgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29793541 |
aagatgggtgtgaggttttctcgaaagatgggtgtttgatggttgatccttttgaagcttgtcaggttgatccaactggggcaggggattgttttcttgg |
29793640 |
T |
|
| Q |
201 |
tgggtttgctgctgggattgtaaagggtttgggtgtctgtggtgctgct |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | || ||||||| |
|
|
| T |
29793641 |
tgggtttgctgctgggattgtaaagggtttgggtgtgtatgatgctgct |
29793689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University