View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_high_139 (Length: 250)
Name: NF1408_high_139
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_high_139 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 30 - 246
Target Start/End: Original strand, 26988606 - 26988822
Alignment:
| Q |
30 |
atactgaagtgaatccggcgaaaccttcaacctcggagaagccaccgccgccgccggagactcaacaaaaggaacagaaaccatttcaacgggtttggag |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
26988606 |
atactgaagtgaatccggcgaaaccttcaacctcggagaagccacagccgccgccggagactcaacaaaaggaacagaaaccatttcaacaggtttggag |
26988705 |
T |
 |
| Q |
130 |
acagcggcggcggtagttgttacgaatggtttgaaacgagggttagggtgaagagtagtgtgctgcattatgtggcggtggttacggaggaggaggggag |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| ||| |
|
|
| T |
26988706 |
acagcggcggcggtagttgttacgaatggtttgaaacgagggttagggtgaagagtagtgtactgcattctgtggcggtggttacggaggaggaggtgag |
26988805 |
T |
 |
| Q |
230 |
ggtgtggctgtgataat |
246 |
Q |
| |
|
| ||||||||||||||| |
|
|
| T |
26988806 |
gttgtggctgtgataat |
26988822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University