View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_high_140 (Length: 250)
Name: NF1408_high_140
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_high_140 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 1 - 181
Target Start/End: Complemental strand, 49918140 - 49917960
Alignment:
| Q |
1 |
atccccagtggtaagttttctatgtgtcacatctggcactgagattagaccatagtccttcatacaatagtcaccaaaggctctagatattgctaatcct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49918140 |
atccccagtggtaagttttctatgtgtcacatctggcactgagattagaccatagtccttcatacaatagtcaccaaaggctctagatattgctaatcct |
49918041 |
T |
 |
| Q |
101 |
ggtgttttaccatttggcatccacaccctatacactcctggttcatctttcatacaaaatacacgtccttttgattctttt |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49918040 |
ggtgttttaccatttggcatccacaccctatacactcctggttcatctttcatacaaaatacacgtccttttgattctttt |
49917960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 14 - 177
Target Start/End: Original strand, 13734463 - 13734626
Alignment:
| Q |
14 |
agttttctatgtgtcacatctggcactgagattagaccatagtccttcatacaatagtcaccaaaggctctagatattgctaatcctggtgttttaccat |
113 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||| ||| |||| || | |||||| |||||||| ||||| |||||||||| |||||| | ||||||| |
|
|
| T |
13734463 |
agttttctttgtgtcacatctggtactgagattagtccaaagtcttttacacaataatcaccaaatgctcttgatattgctagtcctggactcttaccat |
13734562 |
T |
 |
| Q |
114 |
ttggcatccacaccctatacactcctggttcatctttcatacaaaatacacgtccttttgattc |
177 |
Q |
| |
|
|||||||||| || ||||| |||||||||||||||| ||||||||| || | ||| |||||||| |
|
|
| T |
13734563 |
ttggcatccaaactctatatactcctggttcatcttccatacaaaacactcttccgtttgattc |
13734626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University