View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_high_141 (Length: 248)
Name: NF1408_high_141
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_high_141 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 1 - 129
Target Start/End: Complemental strand, 27066961 - 27066833
Alignment:
| Q |
1 |
ccgccgcccatctcttctgcttcccggaactcacaaaacaacgtcctttcgacccctcacatttcactgtctacgaaactgaccagaatttcaccttcta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27066961 |
ccgccgcccatctcttctgcttcccggaactcacaaaacaacgtcctttcgacccctcacatttcactgtctacgaaactgaccagaatttcaccttcta |
27066862 |
T |
|
| Q |
101 |
cagcctcggagagaatttcaccacctatg |
129 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27066861 |
cagcctcggagagaatttcaccacctatg |
27066833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University