View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_high_164 (Length: 228)
Name: NF1408_high_164
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_high_164 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 499441 - 499240
Alignment:
| Q |
1 |
tgtccaatttctttgacgtgaagtagagagacatgtatgtaaaag--tataccatagatcaataaatgttgttaaatcggtatagtattttggcatacac |
98 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
499441 |
tgtccaatttctttgaggtgaagtagagagacatgtatgtaaaagagtataccatagatcaataaatgttgttaaaccggtatagtattttggcatacac |
499342 |
T |
|
| Q |
99 |
ggtgtcaaaatttgcgtaggtgaaccaattataactc-acattttattaatcgatgannnnnnnnnnnnaggaccatcgatgaagaagtaagaacaatga |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
499341 |
ggtgtcaaaatttgcgtaggtgaaccaattataactctacattttattaatcgatgatttttattttttaggaccatcgatgaagaagtaagaacaatga |
499242 |
T |
|
| Q |
198 |
ag |
199 |
Q |
| |
|
|| |
|
|
| T |
499241 |
ag |
499240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University