View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_high_175 (Length: 224)
Name: NF1408_high_175
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_high_175 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 56 - 145
Target Start/End: Original strand, 51962673 - 51962768
Alignment:
| Q |
56 |
ctctgtgatgatttgcttgcttttaatgac----tgattttgaactggcaatgtctatctatctatatat--acacacttttctatgagagatgac |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
51962673 |
ctctgtgatgatttgcttgcttttaatgacaatatgattttgaactggcaatgtctatctatctatatatacacacacttttctatgagagatgac |
51962768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 7 - 55
Target Start/End: Original strand, 44667419 - 44667467
Alignment:
| Q |
7 |
gagacgctttgtgatgcttgtagtattctttgttatcttcattctgttc |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44667419 |
gagacgctttgtgatgcttgtagtattctttgttatcttcattctgttc |
44667467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 59
Target Start/End: Complemental strand, 8374290 - 8374237
Alignment:
| Q |
7 |
gagacgctttgtgatgcttg-tagtattctttgttatcttcattctgttcctct |
59 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
8374290 |
gagacgctttgtgatgcttaatagtattatttgttatcttcattctgttcctct |
8374237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University