View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1408_high_205 (Length: 206)

Name: NF1408_high_205
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1408_high_205
NF1408_high_205
[»] chr8 (1 HSPs)
chr8 (86-204)||(39793435-39793553)


Alignment Details
Target: chr8 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 86 - 204
Target Start/End: Original strand, 39793435 - 39793553
Alignment:
86 ccctgcaacaggtttgtttctactttccacaaaaaggggactgagcacaacaaaagataccatcatacgaagtggtaggttgccnnnnnnnccctacttt 185  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||        |||||  |    
39793435 ccctgcaacaggtttgtttctactttccacaaaaatgggactgagcacaactaaagataccatcatacgaagtggtaggttgccaagaaaaacctacaat 39793534  T
186 taccgccgctaagtataat 204  Q
    |||||||||||||||||||    
39793535 taccgccgctaagtataat 39793553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University