View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_high_41 (Length: 433)
Name: NF1408_high_41
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_high_41 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 81 - 426
Target Start/End: Complemental strand, 12234166 - 12233821
Alignment:
| Q |
81 |
caacagatgagtaatcctcaaccccagcagacacaacctggcatgccgccttctcgttctgatcaacccttcaacggtcgtggccgctctaacttcatgg |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12234166 |
caacagatgagtaatcctcaaccccagcagacacaacctggcatgccgccttctcgttctgatcaacccttcaacggtcgtggccgctctaacttcatgg |
12234067 |
T |
 |
| Q |
181 |
acttcaattaccaaaagtagctcgtatacaacatcaaagtaaatgatttggttacagaatatatttatcccaagtaacatgttgtatatatatgtatgta |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| |||||| |||| |
|
|
| T |
12234066 |
acttcaattaccaaaagtagctcgtatacaacatcaatgtaaatgatttggttacagaatatattcatcccaagtaacatgttgtataaatatgtctgta |
12233967 |
T |
 |
| Q |
281 |
ttacatatatcattgtccttaatcctatgatgttttatgtatcttctacagtttaaggtagaaacatgtcctattattttgtactttctgcagttttata |
380 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12233966 |
ttacatatatcagtgtccttaatcctatgatgttttatgtatcttctacagtttaaggtagaaacatgtcctattattttgtactttctgcagttttata |
12233867 |
T |
 |
| Q |
381 |
ggttagaagtgttcaccctttgaatttgtgttacagttctgtggtg |
426 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12233866 |
ggttagaagtgttcaccctttgaatttgtgttacagttctctggtg |
12233821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University