View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_high_49 (Length: 401)
Name: NF1408_high_49
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_high_49 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 317; Significance: 1e-179; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 30 - 388
Target Start/End: Complemental strand, 52726741 - 52726384
Alignment:
| Q |
30 |
gttatgggtttctttttatactaaaaggttgtggtttttgaaattt-ggaatcccatttcacttcatggattgaaataatattttttggtggaaagattg |
128 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |||||| |||||||||||||||||||||| ||||||||||||||||||| ||| |
|
|
| T |
52726741 |
gttatgggtttctttttatactaa--ggttgtggtttttgaaattttggaatcacatttcacttcatggattgaaagaatattttttggtggaaaggttg |
52726644 |
T |
 |
| Q |
129 |
atagaatttatgattagatattggtataattatcatgctttggctctgctgtaaataagcttcatgccttttcttgacagtaacttcatgcctttgtctt |
228 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52726643 |
atagaatctatgattagatattggtataattatcatgctttggctctgctgtaaataagcttcatgccttttcttgacagtaacttcatgcctttgtctt |
52726544 |
T |
 |
| Q |
229 |
gttgaaaattatggaatagtatatctatgtggccctgctgttttgtggcctaaaatccgtcaccaccaaatggtgacataggaaaaacttggagtctttt |
328 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52726543 |
gttgaaaattatggcatagtatatctatgtggccctgctgttttgtggcctaaaatccgtcaccaccaaatggtgacataggaaaaacttggagtctttt |
52726444 |
T |
 |
| Q |
329 |
gcttttttagatagaatgtataaataatcactgatattggcaccccatccccctatagaa |
388 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52726443 |
gcttttttagatagaatgtataaataatcactgataatggcaccccatccccctatagaa |
52726384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University