View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_high_60 (Length: 365)
Name: NF1408_high_60
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_high_60 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 87; Significance: 1e-41; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 100 - 230
Target Start/End: Complemental strand, 20039570 - 20039445
Alignment:
| Q |
100 |
tcagttgagacatattgacctttttgttgtttcttgtgataagtaggacactcagacatgagatgaccatatccatcacagccaaaacactgtaaacctc |
199 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||||||||||||||| || ||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
20039570 |
tcagttgagacatattgacctttttattgtttcttgagataagtaggacactcggagttgagatgaccatatccatcacagccaaaacattgtaaacctc |
20039471 |
T |
 |
| Q |
200 |
tcccttgtctaggttgatcttcagttttcgt |
230 |
Q |
| |
|
||| ||||||||||||||||||||||| |
|
|
| T |
20039470 |
tcc-----ctaggttgatcttcagttttcgt |
20039445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University