View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_high_68 (Length: 352)
Name: NF1408_high_68
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_high_68 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 164 - 352
Target Start/End: Original strand, 31606901 - 31607089
Alignment:
| Q |
164 |
attaaacttctgattaatgttgatgaatggcaggttggtccaagaacttcaaatgatagacaaaattttccaccaaataacataattcacatgcttggag |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31606901 |
attaaacttctgattaatgttgatgaatggcaggttggtccaagaacttcaaatgatagacaaaattttccaccaaataacataattcacatgcttggag |
31607000 |
T |
 |
| Q |
264 |
gtgcagggttcttatggatgggttggacaggttttaacggaggagcgccttttcaagtgggagagattacatccttggcaatattcaat |
352 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31607001 |
gtgcagggttcttatggatgggttggacaggttttaacggaggagcgccttttcaagtgggagagattacatccttggctatattcaat |
31607089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 15 - 69
Target Start/End: Original strand, 31606813 - 31606867
Alignment:
| Q |
15 |
ttatactaaaattatggtttatttcaaaactttacaaattcaagtaaaattttgc |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
31606813 |
ttatactaaaattatggtttatttcaaaactttacaagctcaagtaaaattttgc |
31606867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University