View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_high_80 (Length: 310)
Name: NF1408_high_80
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_high_80 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 30 - 136
Target Start/End: Complemental strand, 15888571 - 15888465
Alignment:
| Q |
30 |
cgtgttgcgttaacgcagaagctgagagacaagataccttctattgctgctgtgcagctaatagaatgatgtaacatattagttctttatgttttgaatt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15888571 |
cgtgttgcgttaacgcagaagctgagagacaagataccttctattgctgctgtgcagctaatagaatgatgtaacatattagttctttatgttttgaatt |
15888472 |
T |
|
| Q |
130 |
cgtttgt |
136 |
Q |
| |
|
||||||| |
|
|
| T |
15888471 |
cgtttgt |
15888465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 203 - 310
Target Start/End: Complemental strand, 15888398 - 15888291
Alignment:
| Q |
203 |
ttactctaatagggtacatgaagtattcaacaacctttattagttttcttgtataaattacgatgtgaatgctattgcttgtatatcatttaatgttgtt |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15888398 |
ttactctaatagggtacatgaagtattcaacaacctttattagttttcttgtataaattaagatgtgaatgctattgcttgtatatcatttaatgttgtt |
15888299 |
T |
|
| Q |
303 |
tttgttgc |
310 |
Q |
| |
|
|||||||| |
|
|
| T |
15888298 |
tttgttgc |
15888291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University