View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1408_high_9 (Length: 548)
Name: NF1408_high_9
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1408_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 87; Significance: 2e-41; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 30 - 137
Target Start/End: Complemental strand, 51729276 - 51729169
Alignment:
| Q |
30 |
atatgaaacatactttggaagcacgnnnnnnntcctgatttacagcataactctcatttctttttcgacaactttgggcctcaagtttcaactttcacca |
129 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51729276 |
atatgaaacatactttggaagcacgaaaaaaatcctgatttacagcataactctcatttctttttcgacaactttgggcctcaagtttcaactttcacca |
51729177 |
T |
 |
| Q |
130 |
cccagtga |
137 |
Q |
| |
|
|||||||| |
|
|
| T |
51729176 |
cccagtga |
51729169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 242 - 298
Target Start/End: Original strand, 48438464 - 48438520
Alignment:
| Q |
242 |
attccaagcatgaataggtatgccataaatccgaacccaggctcccctttcaaattt |
298 |
Q |
| |
|
|||||||||||| || || || |||||||| |||||||| ||||||||||||||||| |
|
|
| T |
48438464 |
attccaagcatggatgggaataccataaatacgaacccatgctcccctttcaaattt |
48438520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University